5 using different types of accessories in a table view cell
Báo cáo khoa học: "Chinese Term Extraction Using Different Types of Relevance" potx
... the SVM classifier The training and testing sets are not overlapped Table and Table show the performance of the proposed algorithms using different features for IT domain and legal domain, respectively ... performances are evaluated in terms of precision (P), recall (R) and F-value (F) Since the corpora are relatively large, sampling is used for evaluation based on fixed interval of in each 10 ranked ... that the proposed approach are quite stable across domains and the relevance between candidates are efficient for improving performance of term extraction in different domains The algorithm using...
- 4
- 323
- 0
Creation of new magnesium based material using different types of reinforcements
... reported separately in this report for easy readability Creation of New Mg-Based Material Using Different Types of Reinforcements by S Fida Hassan x List of Tables List of Tables Page Table 4.1.1 ... developed by Matsuzawa Japan Microhardness measurements were carried out using a pyramidal diamond intender with a facing angle of 136° employing an indenting load of 25gf and a dwell time of 15 seconds ... using nano-Al2O3 as reinforcement”, Materials Science and Engineering A, 392 (2005) 163-168 S.F Hassan and M Gupta, “Enhancing Physical and Mechanical Properties of Mg Using Nano-Sized Al2O3 Particulates...
- 181
- 1,287
- 0
DescribeCalculate the wetland hydrology of different types of Wetlands in Vietnam
... rise in coastal wetlands and so on A wetland influenced by a drainage basin may receive channelized stream-flow during most or all of the year Wetlands are often an integrated part of a stream ... Vietnam lies in tropical weather zone, and has a long coastal area leading to have a large scale of precipitation and the precipitation is greater than evapotranspiration The change in water budget ... Tra O Marsh Tra O Marsh is located in Phu My- Binh Dinh, and is built up a remarkable area of wetland ecology for Binh Dinh Tra O mash has an abundant water resource, provides water for My Thang,...
- 17
- 449
- 0
Báo cáo y học: "Efficacy of different types of aerobic exercise in fibromyalgia syndrome: a systematic review and meta-analysis of randomised controlled trials" potx
... adequacy of randomisation, concealment of allocation, blinding of outcome assessors and adequacy Page of 14 of data analysis (was intention-to-treat-analysis performed?) (internal validity) Furthermore ... MSc and AB participated in the collection of the data and analysis of the studies (see Materials and methods) AB and MSc participated in the study design and the interpretation of the data All authors ... did not change the significant effect of AE on pain at post treatment, except for a combination of waterbased and land-based AE, total duration of AE >2,000 minutes, frequency of training or >3...
- 14
- 420
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying the ... Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International...
- 9
- 679
- 0
Tài liệu HOW TO HANDLE DIFFERENT TYPES OF RETAIL SHOPPERS AND MAKE SHOPPING A MEMORABLE EXPERIENCE FOR THEM pdf
... foresee in near future with the coming in of retail giants such as Wal-Mart, Carrefour etc A Monthly Double-Blind Peer Reviewed Refereed Open Access International e-Journal - Included in the International ... humble and patient to listen to their knowledgeable views Therefore instead of you doing the talking, let them speak and as soon as you get a cue that they are aware about the product/brand and are ... Refereed Open Access International e-Journal - Included in the International Serial Directories Indexed & Listed at: Ulrich's Periodicals Directory ©, U.S .A. , Open J-Gage, India as well as in Cabell’s...
- 9
- 417
- 0
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf
... with Class I or normal cephalometric values Using Dolphin Imaging and Graphics ® lateral cephalograms of subjects in natural posture were scanned Lateral cephalogram and profile images of each subject ... generate another manipulated images In these created images, hard tissue normal values were altered in at least two standard deviations Facial profile images were digitally manipulated in the anterior-posterior ... suggests that bimaxillary protrusion is more acceptable in Mexican females than in males within the scope of the Latin community An interesting finding was the fact thatgroups O and P assessed male profile...
- 7
- 708
- 0
EVALUATION OF DIFFERENT TYPES OF CHEST SYMPTOMS FOR DIAGNOSING PULMONARY TUBERCULOSIS CASES IN COMMUNITY SURVEYS pot
... screening Indian J Med Res: 1976; 64, 1150-1159 Gopi PG, Subramani R, Radhakrishna S, Kolappan C, Sadacharam K, Devi TS, Freiden TR, Narayanan PR A base line survey of the prevalence of tuberculosis in ... Krishnamacharya L, Devan J, Ponnusamy R, Komaleeswaran G and Prabhakar R A Tuberculosis prevalence survey based on Symptoms questioning and sputum examination Indian J Tuberc 1997; 44: 171-180 Datta ... of cases employing different symptoms inquiry in three disease surveys and the relative merits of each In 1999-2001, a baseline disease survey was conducted in a random sample of 50 villages and...
- 6
- 447
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1)...
- 12
- 588
- 0
Báo cáo khoa học: Drosophila proteins involved in metabolism of uracil-DNA possess different types of nuclear localization signals pdf
... (5¢-CGGCATGGACGAGCTGTACAAGAAGCCCA AAAGGAAGAAGAAGAGGGAGGAGGCGGCGTGAT TCTAGACAGAGC-3¢), UDE346–349-YFP-Rev (5-CGGC ATGGACGAGCTGTACAAGGCAAAGCCCAAAAGGA AGGCGGCGTGATTCTAGACAGAGC-3¢) and yfp-For (5¢-CTAGCAAGCTTACCACCATGGTGAGCAAGGGC ... template, with the forward primers: NLSwtFor (5¢-CTAGCAAGCTTACCACCATGGCGCCAGCTG CCAAGAAGATGAAGATCGACATGGTGAGCAAGG GCGAGGAGCTG-3¢), NLSD(10)12)-For (5¢-CTAGCAAGC TTACCACCATGGCGAAGAAGATGAAGATCGACAT ... (5¢-CTAGCAAGCTTACCACCATGGC GAAGAAGATGAAGATGGTGAGCAAGGGCGAGGA GCTG-3¢) and NLSD10)13-For* (5¢-CTAGCAAGCTTACCA CCATGGCGAAGATGAAGATGGTGAGCAAGGGCGA GGAGCTG’-3), respectively, were used as the forward...
- 15
- 312
- 0
Báo cáo y học: " Replication of the genetic effects of IFN regulatory factor 5 (IRF5) on systemic lupus erythematosus in a Korean population" doc
... Arthritis Research & Therapy Vol No Shin et al laboratory data were obtained: sex, age, ages at onset of first symptom and clinical diagnosis, ACR diagnosis, and Systemic Lupus International ... purposes) Authors' contributions HD Shin and SC Bae have made substantial contributions to study design, acquisition of data, drafting the manuscript, and analysis and interpretation of data YK Sung and ... read and approved the final manuscript Available online http://arthritis-research.com/content/9/2/R32 Additional files The following Additional files are available online: Additional file A...
- 5
- 244
- 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt
... of the hip in identical twins J Bone Joint Surg Br 1959, 41:314-318 Mabuchi A, Nakamura S, Takatori Y, Ikegawa S: Familial osteoarthritis of the hip joint associated with acetabular dysplasia ... Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A functional polymorphism in the 5'UTR of GDF5 is associated with susceptibility ... 12:315-317 Harada M, Takahara M, Zhe P, Otsuji M, Iuchi Y, Takagi M, Ogino T: Developmental failure of the intra-articular ligaments in mice with absence of growth differentiation factor Osteoarthritis...
- 5
- 443
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Metronidazole-induced encephalopathy in a patient with infectious colitis: a case repo" doc
... white matter of the cerebral hemispheres [4,8] Lesions are always symmetric and bilateral, which is a typical pattern of metabolic encephalopathy In each of the cases we reviewed, including ours, ... Therefore, awareness of the potential neurological side effects of metronidazole and an accurate clinical impression of the attending physician is very important in metronidazole-induced encephalopathy ... Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor -in- Chief of...
- 4
- 348
- 0
Báo cáo y học: "Blateral synchronous occurrence of three different histological types of renal tumor: a case report" docx
... the time of diagnosis The classic triad of flank pain, gross hematuria, and palpable abdominal mass is now rarely found Therapy is almost always surgical, either in the form of radical or simple ... your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com Page of (page number ... http://jmedicalcasereports.com/jmedicalcasereports/article /view/ 3/4/6798 Figure Intra-operative images showing (a) removal of three renal tumors in the right kidney as well as (b) intra-operative use of a surgical collagen sponge containing the coagulation...
- 6
- 259
- 0
Báo cáo khoa học: "Incidence of lameness and abrasions in piglets in identical farrowing pens with four different types of floor" pps
... experimental animals Nothing was changed in the management of the four identical farrowing units, but the surface of the floor was altered in two of them, and the amount of bedding was doubled in a third ... abrasions or scabs The skin lesions on the carpus and hock were nearly always bilateral and were observed as early as a few hours after farrowing At days of age, the prevalence of skin lesions at ... scab that is a hard mass mainly of dried blood Sole bruising/Sole erosion Castration wounds Smal part of the volar surface of digit affected Mild inflammation, eczema or oedema Less than half of...
- 9
- 310
- 0
Báo cáo y học: " Use of different but overlapping determinants in a retrovirus receptor accounts for non-reciprocal interference between xenotropic and polytropic murine leukemia viruses" ppt
... saline Endogenous alkaline phosphatase was inactivated by incubating the cells at 68°C for h Cells were then stained for alkaline phosphatase activity by incubating the cells over night in AP ... Figure of Analysis AKR6 and 1E virus interference in CHO cells expressing the AAUU and AAAU chimeric receptors Analysis of AKR6 and 1E virus interference in CHO cells expressing the AAUU and AAAU ... virus binding to cells [25] We found a clear increase in AKR6 virus binding to cells expressing hXpr1 in comparison to cells expressing haXpr1 AKR6 virus binding to cells expressing the AAAU chimeric...
- 12
- 227
- 0
Diatom and geochemical indicators of acidification in a tropical forest stream, singapore 5
... in each sub-sample for multiple analytical techniques including diatom analysis, organic carbon content measurements and geochemical analysis It was decided that a sampling interval of 1cm was ... sediment was placed in a beaker and a small amount of 19% H2O2 added Fresh samples were used as oven drying can result in diatom breakage (Battarbee et al, 2001) When foaming, if any, had subsided, ... diatoms in low-alkalinity lakes in North America (Camburn and Charles, 2000), and various online sources including the Royal Botanic Garden Edinburgh (RBGE, 2010), the Academy of Natural Science in...
- 12
- 204
- 0
Bơm ECD-V - P - Types of Systems in ECD-V Series
... manifold, and enters the cylinders The venturi consists of a "main valve" and a "sub valve" The main valve opens and closes in unison with the accelerator pedal to draw the amount of air that is ... engine ECU calculates the fuel injection volume and the injection timing that are necessary for operating the engine in an optimal state, and actuates the valves The control system can be broadly ... computers, and actuators 2-1 Outline of Intake Air System After being filtered through the air cleaner, the intake air travels through the turbocharger and the venturi, passes through the intake manifold,...
- 4
- 563
- 2
Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"
... 2004:1866 Campbell M Natural history of coarctation of the aorta Br Heart J 1970, 32:633-640 Jenkins NP, Ward AR Coarctation of the aorta: natural history and outcome after surgical treatment QJM ... of surgical repair of coarctation of the aorta in patients older than 50 years Ann Thorac Surg 2001; 72: 2060– 2064 Discussion Aortic coarctation is a congenital vascular lesion typically diagnosed ... trends, and epidemiology of coarctation of the aorta in a population-based study Int J Cardiol 1999, 68:197-202 Cevik S, Izgi C, Cevik C Asymptomatic severe aortic coarctation in an 80-year-old man...
- 2
- 487
- 0
Báo cáo y học: "Efficacy of Sirolimus-Eluting Stents Compared With Paclitaxel-Eluting Stents in an Unselected Population With Coronary Artery Disease: 24-Month Outcomes of Patients in a Prospective Non-randomized Registry in Southern Turkey&
... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; ... adverse cardiac events (MACE), including cardiac death, myocardial infarction (MI), and target vessel revascularization (TVR) MI was defined as the elevation of creatine kinase (CK) > times above ... achieve maximal vasodilatation The use of glycoprotein IIb/IIIa inhibitor (Tirofiban) was at the operator’s discretion All patients maintained antiplatelet therapy after the procedure (aspirin 300...
- 6
- 627
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng 9 tr 25